M S U D Newsletter Volume 17 #2

M S U D Newsletter

Articles Selected from Vol. 17, No. 2, Fall/Winter 1999/2000

SICK DAYS AND HELP LETTERS

Rebecca S. Wappner, M.D.

We have not printed information on the need for medical letters for quite a few years.Ê Dr. Rebecca S. Wappner is Professor and Section Director of Pediatric Metabolism and Genetics at Riley Hospital for Children in Indianapolis, Indiana.Ê She kindly consented to write about the steps to take in times of sickness including the need for a medical (help) letter.

Sick Days

Everyone with a child who has a metabolic disorder needs to be prepared for those days when the child experiences the flu or a cold and changes need to be made in nutrient intake.Ê With the increased fluid and caloric requirement associated with fever, children with metabolic disorders are at risk of having their disorder become uncontrolled.Ê The best way to prevent this is to increase calories and fluids and reduce the amount of natural protein that is usually taken.Ê Every patient should have a sick day plan and a sick day diet individualized for them by their metabolic staff.

The sick day diet should be started when the individual develops the flu, cold, or other illnesses which decrease appetite.Ê The metabolic doctor should be contacted to see what other measures need to be taken.Ê If you havenât received a return phone call from the metabolic clinic, and you know the sick day plan needs to start, do not hesitate to start it.Ê (An extra batch of formula can always be discarded if not needed.)

For MSUD, the sick day diet is usually 110% to 150% of the usual amount of special medical food (supplement devoid of the branched-chain amino acids) plus additional isoleucine and valine.Ê The isoleucine and valine are calculated at the usual daily dietary intake of the branched-chain amino acids (BCAAs) when milk, regular formula, and/or food is included.Ê If any table foods are taken, they should contain minimal or no leucine so leucine intake is lowered to near zero.Ê The goal is to keep the caloric intake high enough to prevent catabolism or breakdown of the body stores ofÊ protein.Ê Urine DNPH testing should be done at least twice a day and a blood test taken to check the level of the BCAAs.Ê

A relatively new drug, Zofran (ondansetron), is now available in a tablet/pill form, in addition to the previously available (expensive) IV form, and can be used to prevent vomiting, especially if the vomiting is related to a gastroenteritis (stomach flu).Ê Phenergan can also be used, but may cause sleepiness.Ê Kaopectate and Imodium-AD can be taken for diarrhea.Ê Check with the doctor for appropriate doses for the age of the child.Ê Also check about any other cold remedies or medications.

As the individual improves, go back to the usual daily formula, and slowly increase the leucine from natural foods over a few days.Ê Be sure to continue to monitor urine DNPH during the time of increasing leucine intake in case a rebound occurs.

Help Letters

Despite early planning and starting sick day formulas, sometimes we are unable to stop an episode of metabolic decompensation÷or, vomiting and/or diarrhea continue.Ê It is now time to go to the hospital before things get worse.Ê Every child with MSUD or an organic acidemia should have a ãHelp Letterä written by their clinic which the family carries with them at all times.Ê This ãHelp Letterä should contain:

á Patientâs name and date of birth.

á Diagnosis and a brief explanation of the diagnosis÷short, clear, and just enough of the ãscaryä information to make the ER staff move into action.Ê Example:Ê MSUD is a disorder of BCAA metabolism that results in elevated blood levels of the BCAAs÷leucine, isoleucine, and valine.Ê Untreated the disorder can result in vomiting, abnormal neurologic findings, an odor of maple syrup (from abnormal BCAA metabolites), hypoglycemia, acidosis, hyperammonemia, lethargy, coma, and death.Ê MSUD is treated with a special diet, low in leucine, using special medical foods and a limited amount of natural protein foods.Ê Persons with MSUD are at risk for metabolic decompensation at times of decreased caloric intake, i.e., with flu, colds, fasting, or vomiting.

á Specific directions for the ER staff.Ê Example:Ê If patientâs name presents to you for emergency care, it is most important that you see her/him immediately.Ê Blood should be taken for a Dextrostix, electrolytes with CO₂ level, serum osmolality, and quantitative amino acids.Ê Urine should be sent for urinalysis and osmolality.Ê If she/he is symptomatic (vomiting, lethargic) do not wait for the results of the studies, but proceed with an IV with D5/W ¸ normal saline and run it at a maintenance rate.Ê Give 2 mEq/Kg sodium bicarbonate as a slow bolus over 20-30 minutes (dilute 1:1 with IV fluids).Ê Watch carefully for signs of increased intracranial pressure; give Mannitol if pressure is present.Ê If you call us when patientâs name is in your ER, we would be most willing to assist you in her/his care and give additional instructions.

á Specific instructions for contacting the metabolic staff in charge of the patient.Ê Example: We can be reached by calling Clinicâs number during working hours, or by calling emergency number after hours and weekends, and asking for name(s) of person(s).Ê

Families should plan ahead when traveling in case an episode of metabolic decompensation occurs.Ê Prior to a trip, you should:

á Make sure you have extra copies of the ãHelp Letter.ä

á Make sure you have supplies you might need if an episode of decompensation starts: Zofran tablets and Kaopectate, extra isoleucine and valine for MSUD, and a supply of IV L-carnitine and protein-free powder for organic acidemias.

Ask your metabolic clinic for a list of the childrenâs hospitals and other metabolic staff along your route.Ê You may even considering driving a certain way, just to be closer to a metabolic clinic in case you need help.

GENETICS PRIMER

Erik G. Puffenberger, Ph.D., Clinic for Special Children

The progress in gene repair therapy prompts a deeper interest in genetics for persons involved with MSUD.Ê Dr. Erik Puffenberger, is the Asst. Laboratory Director/Geneticist at the Clinic for Special Children in Strasburg, Pennsylvania where the first trials in gene repair therapy are scheduled to take place.Ê This article is reprinted with permission from the summer â99 issue of the Clinic for Special Children Newsletter.

We lay persons find it hard to understand genetics.Ê Dr. Puffenberger uses the analogy of the chromosomes as a set of encyclopedias, making complicated genetics easier to understand.Ê He lists the mutations that can currently be detected by tests for carrier status at the Clinic.

The human body is composed of approximately 75 trillion cells.Ê Groups of similar cells in the body are organized into tissues and organs (e.g., liver or kidney) which have specific functions (e.g., digestion, respiration, and circulation).Ê However, all cells, no matter what their function in the human body, contain the full complement of genetic material that we call DNA.Ê DNA is a chemical component of every cell that acts as the blueprint for growth, development, and regulation of all aspects of body chemistry.

What is DNA?

Deoxyribonucleic acid (DNA) is the hereditary material of the human body.Ê DNA is made up of four different chemical compounds, namely adenine (A), guanine (G), cytosine (C) and thymine (T).Ê These four chemicals are linked together into a long string.Ê Within each cell in the body, these strands of DNA exist in a very ordered fashion, namely as chromosomes.

What is a chromosome?

Each cell contains 46 very long strands of DNA that are called chromosomes.Ê Both the egg and sperm carry half the normal complement of chromosomes (i.e., 23).Ê Once fertilization occurs, the new embryo contains a full set of chromosomes (46), half (23) derived from the father and half (23) from the mother.Ê However, these chromosomes are not all different.Ê The chromosome set inherited from the mother contains the same chromosomes as the set from the father.Ê Thus, while each cell carries 46 chromosomes, there are two copies of each chromosome per cell.Ê As an analogy, imagine the chromosomes as a ã46-volume set of encyclopedias.äÊ The ãcomplete setä is composed of two identical 23-volume sets. ÊOne 23-volume set is inherited from the father and the other [set] from the mother.Ê Thus, there are two copies of volume 1, two copies of volume 2, etc.

What is a gene?

A gene is a discrete section of DNA which has a specific function.Ê Each gene is encoded by a specific and unique portion of DNA on a chromosome.Ê Genes are the blueprints for manufacturing the materials that the body requires in order to function properly.Ê Every protein and enzyme found in the human body is produced from the instructions found within the genes.Ê It is estimated that there are approximately 50,000 genes found on the human chromosomes.

Based upon the encyclopedia analogy, each page in the set of encyclopedias would carry the instructions for a single gene.Ê Since there are two copies of each volume in the set of encyclopedias, then it follows that there are also two copies of every page (and thus, two copies of every gene).Ê These encyclopedias, however, are not written with the usual 26-letter alphabet, but rather by a simpler four letter alphabet, corresponding to the four chemical compounds which make up DNA (A, G, C, and T).Ê Thus, a page torn out of one of these books might read like this:

ÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊÊ ... ATGCTAGACCATCAGACTATTCCGTATTGA ...

How is the gene read?

The body has a very complex method for reading the gene letter sequence and converting it into a protein or enzyme.Ê Proteins and enzymes are composed of a set of twenty different amino acids.Ê Each protein has a unique sequence of amino acids bound together in a long string.Ê But how does the text of the gene get converted into the amino acid string called a protein?Ê All genes begin with the same three letters÷ATG.Ê From this initiator, the letters of the gene are read in sets of threes called codons.Ê There are a total of 64 possible codons, each of which signifies a different amino acid.Ê There are also three stop codons which signal the end of the gene ÷TAA, TAG, or TGA.

Using the short gene sequence from above, the figure below illustrates the method by which the DNA is read:

As the cellular machinery for reading the DNA moves along the strand of DNA, it reads the codons and translates that message into the corresponding amino acid.Ê Since there are 64 possible codons but only 20 amino acids, most amino acids are coded by several different codons.Ê For example, the amino acid isoleucine is coded by ATT, ATC, and ATA.Ê Each amino acid is bound to the next in a stepwise fashion creating a long string of amino acids until the end of the gene (stop codon) is reached.

What is a mutation?

A mutation is an alteration in the letter sequence of a gene which causes the gene product, a protein or enzyme, to be manufactured incorrectly.Ê When a protein is made improperly, it is usually ineffective and thus cannot perform its intended function.Ê This lack of function often leads to disease.Ê This is analogous to a typographical error on a single page of text in the 46-volume set of encyclopedias.

Are all mutations alike?

There are several different types of mutation which can alter a gene.Ê First, there is the point mutation.Ê This is the most common form.Ê This type of mutation changes a single letter in the gene text.Ê This typographical error results in the substitution of one amino acid for another in the protein.Ê Using the letter sequence mentioned earlier, a point mutation has been introduced into the gene sequence below.

The mutation is marked by an asterisk in codon number 3. This substitution changes a C to an A.Ê This alters the codon so that it no longer designates aspartate (codon GAC), but rather specifies glutamine (GAA).Ê Most mutations of this type change a single amino acid within the protein, leaving the rest of the protein unaffected.Ê The protein is usually manufactured, but often lacks proper function due to the incorrect placement of one amino acid.

A second type of mutation is called a deletion.Ê ÊDeletions may be large or small.Ê Some deletions result in the loss of a single letter in the gene, while others may encompass many hundreds or thousands of letters.Ê When some of the gene code is deleted, the protein often cannot be manufactured at all.Ê The figure below illustrates a single letter deletion in codon three.Ê The original codon 3 was GAC.Ê In this example, the G has been deleted so the codon now reads ACC.Ê This deletion shifts all the other letters forward in the sequence and disrupts the normal reading frame of the gene.Ê As a result, the amino acids incorporated into the protein after the deletion are incorrect.Ê This type of mutation often results in a non-functional protein.

A third form of mutation is called an insertion.Ê As the name implies, an insertion adds extra letters to the text of the gene.Ê Like the deletion mutation, this type may be small (a single letter insertion) or large (many hundreds or thousands or letters).Ê The end result, though, is the same as a deletion mutation: the protein is manufactured improperly, if at all.Ê As an example, the sequence below has a G insertion in codon 3 (denoted by the outlined letter G).Ê This insertion changes the third codon from GAC to GGA and substitutes glycine for aspartate in the protein.Ê In addition, this insertion causes the reading frame to shift so that all subsequent amino acids are incorrect.

If I carry a mutation, why am I not sick?

Most of the genetic diseases we treat at the Clinic for Special Children are recessive.Ê For a recessive genetic disease, both parents are "carriers" of a silent mutation.Ê The mutation is silent in that there is no clinical consequence in being a carrier.Ê Recall that each cell in the body has two copies of every gene, one inherited from the father and one from the mother.Ê The carrier has one version of the gene which has a mutation, while the other copy is normal.Ê The normal copy is able to "mask" the presence of the mutant copy by providing the cells of the body with enough protein to function normally.Ê However, when both copies of a gene contain a mutation, there is no normal protein produced.Ê This leads to disease.

In the diagram below, the N represents the normal gene sequence and the M represents the mutant gene sequence.Ê The diagram shows that, on average, one out of four children (25%) will inherit two copies of the abnormal gene and, thus, develop the disease.Ê In addition, three out of four children will be unaffected by the disease, but, on average, two of these three will be carriers.Ê The probability of having an affected child remains the same regardless of the number of affected or unaffected children already born to the couple.

A recessive genetic disease occurs in a child only if both parents carry a mutation in the same gene.Ê This circumstance is usually rare.Ê However, in plain [Mennonite & Amish] communities, the incidence of consanguineous marriages is much higher than the general population.Ê A consanguineous marriage is the union of two individuals who are genetically related.Ê A consanguineous union may be a relatively close relationship (second cousins) or it may be more distant (sixth cousins).Ê Due to the relatively small number ofÊ Mennonite and Amish founders and the lack of migration into the group over the past two centuries, most contemporary Mennonite and Amish individuals are related to their spouses.Ê The closer the relationship between these two individuals, the greater is the probability that they will produce offspring with a genetic disease

How can mutations be detected?

Once a mutation has been identified in a gene, a specific test can be designed to identify individuals who carry that mutation.Ê The Clinic for Special Children offers genetic testing for carrier status for several inherited diseases, namely maple syrup urine disease (MSUD), glutaric aciduria, type 1 (GA1), medium-chain acyl-CoA dehydrogenase deficiency (MCADD), glycogen storage disease, type 6 (GSDVI), pyruvate kinase deficiency (PKD), congenital nephrotic syndrome (NPHS1), Byler disease (FICl), Hirschsprung disease (HSCR), and Crigler-Najjar syndrome, type 1 (CN1).

For each disorder, the test performed identifies a single mutation in the gene (namely Y393N for MSUD, A421V for GA1, K304E for MCADD, IVS13+1G for GSDVI, R479H for PKD, 1481delC for NPHS1, G308V for FIC1, W276C for HSCR, and Y74X for CN1).Ê Currently, research indicates that a single gene mutation for each disorder is found among the Mennonite and Amish populations of Lancaster County, PA.Ê These tests do not detect other mutations within these genes which may cause disease.

NEWS & NOTES

MSUD Picnic in Pennsylvania

On August 28, 1999 we hosted an MSUD picnic on our farm.Ê It was a beautiful day.Ê There were approximately 90 people here for lunch.Ê There were 8 MSUD families and some relatives, plus the five families here in Blair County, Pennsylvania.Ê There were 21 children with MSUD.Ê The parents and children had a wonderful time of fellowship and exchanging news.

Dr. Morton and his wife, Caroline, spent a few hours with us, bringing along Seth and Sandy Hammers and their baby, Joshua, from New Jersey.Ê Dr. Morton had discharged baby Joshua from the Lancaster General Hospital that morning.

I do believe the childrenâs highlight was the food.Ê Our menu consisted of low protein bread and buns, veggie burgers and even low protein hot dogs.Ê We also had baked potatoes, green beans in a sauce, sweet corn, low pro macaroni and cheese, and lettuce salad.Ê For dessert there were low protein cookies, melon balls with grapes, and low protein soft ice cream out of a rented soft ice cream machine.Ê (See the RECIPES section for the low protein ice cream recipe.)Ê One side of the machine dispensed ãregularä ice cream and the other side low protein ice cream.Ê The first person to fill a cone was a child with MSUD.Ê He was so excited, he filled his cone with regular ice cream before realizing, ãOops, wrong ice cream.äÊ Both kinds looked exactly the same.

÷Martha Newswanger

Gene Repair Therapy Update

The gene repair therapy project is continuing, albeit slowly.Ê A young manâs death after gene therapy was widely reported in the news. ÊThis recent tragedy raised serious questions about gene therapy.Ê The good news is that the gene repair therapy by Kimeragen does not use viruses as carriers for the gene.Ê Even the modified viruses used in most gene therapy can cause inflammatory responses.Ê The gene repair that is the hope for a cure in MSUD uses a molecule called a chimeraplast÷a combination of DNA and RNA sequences that direct the bodyâs own molecular tools to repair the gene.Ê It differs from regular gene therapy and is expected to reduce the risks.

Human trials on children with Crigler-Najjar Disease are planned for sometime next year.Ê Extensive testing is being done to insure the safety of the therapy.

÷Joyce Brubacher from a conversation with Dr. Michael Blaese

RECIPES

Bread

Submitted by Nancy Benedict

400 g Wheatstarch

2 t. yeast

1 T. methycellulose^_

400 g water

2 T. psylluim fiber^_

1 T. oil

2 T. sugar

1 t. vinegar

1 t. salt

Combine dry ingredients in mixing bowl.Ê Add water, oil, and vinegar.Ê Mix for 2 minutes.Ê Let set for 30 minutes.Ê Mix again for 2 to 3 minutes.Ê Place into well-greased bread pan.Ê Let rise until bread is about 1 inch above pan.Ê Bake at 350¡ for 40-45 minutes.Ê Cut into 14 slices.

_Both ingredients are available from Ener-G Foods.

Leucine

Protein

Calories

Per serving:

15 mg

0.2 g

119

Per recipe:

214 mg

3.0 g

1671

Dinner Rolls

Follow the bread recipe above but divide dough into 12 pieces instead of putting into pan.Ê Shape each piece into a dinner roll.Ê Put into a well-greased baking pan.Ê Let rise until double.Ê Bake at 350¡ for 25 to 30 minutes.Ê Makes 12 rolls.

Leucine

Protein

Calories

Per serving:

18 mg

0.3 g

139

Per recipe:

214 mg

3.0 g

1671

Soft Pretzels

1 recipe bread dough (recipe above)

Coarse pretzel salt

1 T. baking soda

4 T. melted butter

Follow the bread recipe but divide dough into 8 pieces instead of putting into pan.Ê Roll each piece into a long rope and twist into pretzel shape.Ê Add baking soda to 2 cups water.Ê Dip each pretzel into water and place on a well-greased baking sheet.Ê Sprinkle with salt.Ê Let rise 30 minutes.Ê Bake at 400¡ till browned, about 12 to 15 minutes.Ê Dip into melted butter.Ê Makes 8 pretzels.

Leucine

Protein

Calories

Per serving:

33 mg

0.4 g

260

Per recipe:

261 mg

3.5 g

2076

Pizza

1 recipe bread dough (first column)

¸ c. onions, sliced

2/3 c. tomato sauce

¹ c. peppers, sliced

4 oz. low pro mozzarella cheese, shredded^_

¸ c. mushrooms, sliced

1 T. butter

Follow the bread recipe but divide dough into 2 pieces instead of putting into pan.Ê Pour ¹ inch oil into a 15-inch cast iron skillet.Ê Press one piece of dough into a 15-inch circle on waxed paper.Ê Transfer to a skillet, and remove paper.Ê Spread with 1/3 cup sauce and 1/2 of the cheese.Ê Saute onions, peppers, and mushrooms in melted butter until soft.Ê Spread one-half of the vegetable mixture on top of the cheese.Ê Bake on lowest rack in oven preheated to 450¡ for 12 to 15 minutes.Ê Repeat with remaining dough.Ê This makes a pizza similar to Pizza Hut pan pizza.Ê 16 servings.

_ Cheese available from Ener-G Foods.

	Leucine	Protein	Calories
Per serving:	39 mg	0.6 g	136
Per recipe:	621 mg	9.1 g	2173

Low Protein Ice Cream

Submitted by Martha Newswanger

2 c. Richâs Coffee Rich

2 to 3 t. vanilla

2 c. Richâs Richwhip Topping (liquid)*

1/8 t. salt

3/4 c. sugar

Combine all ingredients and pour into ice cream freezer.Ê Freeze following manufacturerâs directions.Ê 12 - ¸ c servings.

* Other non-dairy products may be higher in protein.

	Leucine	Protein	Calories
Per serving:	9 mg	0.2 g	222
Per recipe:	108 mg	1.8 g	2658

Apple Salad

Submitted by Elsie Newswanger

6 apples, chopped

2 bananas, sliced

¸ c. raisins

1 c. miniature marshmallows

Dressing:

1 c. sugar

1 c. water

2 T. cornstarch or clear jel

1 T. butter

¸ c. water

1 T. vinegar

Combine fruit and marshmallows and set aside.Ê Mix sugar, cornstarch, and ¸ cup water.Ê Bring remaining cup water to a boil and slowly add cornstarch mixture, stirring until thickened. ÊAdd butter and vinegar.Ê Cool.Ê Toss fruit with dressing just before serving. 10 - 1 cup servings.

	Leucine	Protein	Calories
Per serving:	39 mg	0.8 g	215
Per recipe:	390 mg	8.4 g	2153